Taller de aplicación Código genético

TALLER   3

OBJETIVO:

Valorar la importancia de las bases nitrogenadas que dan origen a los aminoácidos y estos a las proteínas.

  1. En un gráfico señale las  secuencias de intrones y exones  en el procesamiento del RNAm
  1. Cuál es el procesamiento diferencial del RNAm  Hágalo en un gráfico.
  2. Qué anticodón cree que tendrá un RNAt portador de isoleusina? . Es posible más de una respuesta.  Si es así indique todas las alternativas  posibles.
  3. En qué segmento hipotético de una cadena de ADN la secuencia de base (3´)AAGTTTGGTTACTTG (5´). Cuál sería las secuencias de bases de una cadena de RNAm transcripta a partir de un segmento de DNA?
  4. Suponga que usted tiene un peptido arg – lys – pro – met. Y usted sabe que las moléculas de RNAt  usadas en su síntesis tiene los siguientes anticodones      (3´) GGU (5´) ; (3´) GCU (5´) ; (3´) UUU (5´) ; (3´) UAC (5´). Determine las secuencias de nucleotidos de DNA para la cadena molde del gen que codifica para este ejemplo.
  5. Describa las características fundamentales del código genético.
  6. Qué es un codón? Discrimine    codón—–anticodón.
  7. Discrimine las características principales de las tres etapas de la síntesis de proteínas.
  8. Utilizando el código genético complete la siguiente tabla, considere que le lectura se produce de izquierda  a derecha y que las columnas representan alineaciones transcripcionales y traduccionales.
C DNA

Doble

T G A Helice
C A U RNAmTranscrito
G C A Anticodón RNAt
Treonina Amino

ácidos

  1. Escriba el RNAm  y el polipéptido codificado por el siguiente DNA

(5´) TACGAACAAGTGTCGGTTACCATT (3´)

  1. Indique el nombre de los aminoácidos dictados por el siguiente RNAm

(5´) CCAACCACUGCAUUAUUGCCA (3´)

AA: _________________________________________________________________

Sor María Lilia Guerrero

Etiquetas:

Responder

Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Cerrar sesión / Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión / Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión / Cambiar )

Google+ photo

Estás comentando usando tu cuenta de Google+. Cerrar sesión / Cambiar )

Conectando a %s


A %d blogueros les gusta esto: